WormBase Tree Display for Variation: WBVar02150888

WBVar02150888 Name: Public_name: tm4812
    HGVSg: CHROMOSOME_V:g.13961170_13961594del
  Sequence_details: SMap: S_parent: Sequence: R10D12
    Flanking_sequences: gaaaggcacgcacactaaacaaaaagtaaa acaatctgaaaatcattacatttttcaaga
    Mapping_target: R10D12
    Source_location: 7 CHROMOSOME_V 13961169 13961595 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4812_external
      tm4812_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4812
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00011193
    Transcript: R10D12.12.1 VEP_consequence: coding_sequence_variant,3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 292-?
        CDS_position: 270-?
        Protein_position: 90-?
        Exon_number: 4-5/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Remark: 28550/28551-28975/28976 (425 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele