WormBase Tree Display for Variation: WBVar02150726

WBVar02150726 Name: Public_name: tm2576
    Other_name: CE45368:p.Thr33SerfsTer82
      F54C8.4b.1:c.96_558del
      F54C8.4a.1:c.348_810del
      CE00190:p.Thr117SerfsTer82
    HGVSg: CHROMOSOME_III:g.9442028_9442536del
  Sequence_details: SMap: S_parent: Sequence: F54C8
    Flanking_sequences: attggctccgtttgcaacaggttgattgag taatcttgaattacttgatggaaggactca
    Mapping_target: F54C8
    Source_location: 7 CHROMOSOME_III 9442027 9442537 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2576_external
      tm2576_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2576
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00010037
    Transcript: F54C8.4b.1 (11)
      F54C8.4a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Remark: 8131/8132-8640/8641 (509 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele