WormBase Tree Display for Variation: WBVar02150227
expand all nodes | collapse all nodes | view schema
WBVar02150227 | Name | Public_name | tm12664 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_IV:g.3915506_3915918del | |||||||
Sequence_details | SMap | S_parent | Sequence | F56D6 | ||||
Flanking_sequences | aaaactttttttcatgctgtgatcttcaaa | ctgtaataatttttatcattcttgcttata | ||||||
Mapping_target | F56D6 | |||||||
Source_location | 7 | CHROMOSOME_IV | 3915505 | 3915919 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 12664 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018973 | ||||||
Transcript | F56D6.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-261 | |||||||
CDS_position | ?-247 | |||||||
Protein_position | ?-83 | |||||||
Intron_number | 2/7 | |||||||
Exon_number | 1-3/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Remark | 25306/25307-25719/25720(413 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |