WormBase Tree Display for Variation: WBVar02148895
expand all nodes | collapse all nodes | view schema
WBVar02148895 | Evidence | Paper_evidence | WBPaper00053300 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | jy1 | |||||||
Other_name | C29F9.1.1:c.151C>T | ||||||||
CE08449:p.Arg51Ter | |||||||||
HGVSg | CHROMOSOME_III:g.132575C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C29F9 | |||||
Flanking_sequences | gggattcatgctcaagcgggatgtgcgact | gacctatcagtgctcatatcgtgcctcaa | |||||||
Mapping_target | C29F9 | ||||||||
Type_of_mutation | Substitution | C | T | Person_evidence | WBPerson3965 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007237 | ||||||||
WBStrain00056787 | |||||||||
WBStrain00056788 | |||||||||
WBStrain00056790 | |||||||||
Laboratory | ERT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00016216 | |||||||
Transcript | C29F9.1.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C29F9.1.1:c.151C>T | ||||||||
HGVSp | CE08449:p.Arg51Ter | ||||||||
cDNA_position | 158 | ||||||||
CDS_position | 151 | ||||||||
Protein_position | 51 | ||||||||
Exon_number | 2/6 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor | WBInteraction000561571 | ||||||||
WBInteraction000583597 | |||||||||
WBInteraction000583598 | |||||||||
WBInteraction000583600 | |||||||||
WBInteraction000583601 | |||||||||
WBInteraction000583605 | |||||||||
WBInteraction000583606 | |||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | Screen for constitutive pals-5::GFP expression | ||||||||
Genetics | Interpolated_map_position | III | -26.9838 | ||||||
Description | Phenotype | WBPhenotype:0000295 | Paper_evidence | WBPaper00053300 | |||||
WBPaper00059442 | |||||||||
Curator_confirmed | WBPerson3965 | ||||||||
Remark | (Fig. 1B) | Paper_evidence | WBPaper00059442 | ||||||
Curator_confirmed | WBPerson3965 | ||||||||
Phenotype_assay | Strain | WBStrain00049931 | Paper_evidence | WBPaper00059442 | |||||
Curator_confirmed | WBPerson3965 | ||||||||
WBPhenotype:0000848 | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
Remark | The pals-22(jy1) mutation causes developmental delay (Fig. S7) | Paper_evidence | WBPaper00059442 | ||||||
Curator_confirmed | WBPerson3965 | ||||||||
The rcs-1(jy84) mutation does not affect the developmental delay of pals-22(jy1) mutants (Fig. S7) | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
The skr-3(ok365);skr-5(ok3068) double mutant does not affect the developmental delay of pals-22(jy1) mutants (Fig. S7) | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
The skr-3(ok365);skr-4(gk759439) double mutant does not affect the developmental delay of pals-22(jy1) mutants (Fig. S7) | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
The skr-5(ok3068);skr-4(gk759439) double mutant does not affect the developmental delay of pals-22(jy1) mutants (Fig. S7) | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
Phenotype_assay | Strain | WBStrain00049931 | Paper_evidence | WBPaper00059442 | |||||
Curator_confirmed | WBPerson3965 | ||||||||
WBStrain00052718 | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
WBStrain00052719 | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
WBStrain00052721 | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
WBStrain00052724 | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
Control_strain | WBStrain00049931 | Paper_evidence | WBPaper00059442 | ||||||
Curator_confirmed | WBPerson3965 | ||||||||
WBStrain00052720 | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
WBStrain00052722 | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
WBStrain00052723 | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
Genotype | rcs-1(jy84) X | Paper_evidence | WBPaper00059442 | ||||||
Curator_confirmed | WBPerson3965 | ||||||||
skr-3(ok365) skr-5(ok3068) V | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
skr-3(ok365) skr-4(gk759439) V | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
skr-5(ok3068) skr-4(gk759439) V | Paper_evidence | WBPaper00059442 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00056034 | |||||||
Curator_confirmed | WBPerson3965 | ||||||||
Remark | pals-22(jy1) confers an increased resistance to intracellular pathogens | Paper_evidence | WBPaper00056034 | ||||||
Curator_confirmed | WBPerson3965 | ||||||||
EQ_annotations | GO_term | GO:0098542 | PATO:0000460 | Paper_evidence | WBPaper00056034 | ||||
Curator_confirmed | WBPerson3965 | ||||||||
WBPhenotype:0002474 | Paper_evidence | WBPaper00061877 | |||||||
Curator_confirmed | WBPerson23334 | ||||||||
Phenotype_not_observed | WBPhenotype:0002252 | Paper_evidence | WBPaper00061877 | ||||||
Curator_confirmed | WBPerson23334 | ||||||||
Reference | WBPaper00053300 | ||||||||
WBPaper00056034 | |||||||||
WBPaper00061877 | |||||||||
WBPaper00065984 | |||||||||
WBPaper00059442 | |||||||||
Remark | Created in the nameserver by Chris Grove | ||||||||
WBPaper00053300, allele of pals-22 | |||||||||
amino acid 51: CGA (R) to TGA (stop) | |||||||||
[200207 gw3] Corrected flanking sequences | |||||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00016216 Opal_UGA | |||||||||
Method | Substitution_allele |