WormBase Tree Display for Variation: WBVar02148380
expand all nodes | collapse all nodes | view schema
WBVar02148380 | Name | Public_name | tm10645 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T09A12.4c.1:c.638-19_721+4del | |||||||
T09A12.4a.1:c.176-19_259+4del | ||||||||
T09A12.4f.1:c.638-19_721+4del | ||||||||
T09A12.4b.1:c.4_106+4del | ||||||||
T09A12.4h.1:c.176-19_259+4del | ||||||||
T09A12.4d.1:c.416-19_499+4del | ||||||||
T09A12.4j.1:c.4_106+4del | ||||||||
T09A12.4g.1:c.416-19_499+4del | ||||||||
HGVSg | CHROMOSOME_IV:g.8229245_8229351del | |||||||
Sequence_details | SMap | S_parent | Sequence | T09A12 | ||||
Flanking_sequences | tgaaatttcctacagaaaactaaaaaagac | cattacagttaatattttgatctttatttg | ||||||
Mapping_target | T09A12 | |||||||
Source_location | 7 | CHROMOSOME_IV | 8229244 | 8229352 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm10645_external | |||||||
tm10645_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (6) | ||||||||
Affects | Gene | WBGene00003656 | ||||||
Transcript | T09A12.4i.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 1/7 | |||||||
Exon_number | 1/8 | |||||||
T09A12.4c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T09A12.4c.1:c.638-19_721+4del | |||||||
Intron_number | 5-6/13 | |||||||
Exon_number | 6/14 | |||||||
T09A12.4b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T09A12.4b.1:c.4_106+4del | |||||||
cDNA_position | 2488-? | |||||||
CDS_position | 4-? | |||||||
Protein_position | 2-? | |||||||
Intron_number | 2/9 | |||||||
Exon_number | 2/10 | |||||||
T09A12.4f.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T09A12.4f.1:c.638-19_721+4del | |||||||
Intron_number | 5-6/13 | |||||||
Exon_number | 6/14 | |||||||
T09A12.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T09A12.4a.1:c.176-19_259+4del | |||||||
Intron_number | 1-2/9 | |||||||
Exon_number | 2/10 | |||||||
T09A12.4d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T09A12.4d.1:c.416-19_499+4del | |||||||
Intron_number | 3-4/10 | |||||||
Exon_number | 4/11 | |||||||
T09A12.4g.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T09A12.4g.1:c.416-19_499+4del | |||||||
Intron_number | 3-4/10 | |||||||
Exon_number | 4/11 | |||||||
T09A12.4j.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T09A12.4j.1:c.4_106+4del | |||||||
cDNA_position | 227-? | |||||||
CDS_position | 4-? | |||||||
Protein_position | 2-? | |||||||
Intron_number | 2/9 | |||||||
Exon_number | 2/10 | |||||||
T09A12.4e.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1/7 | |||||||
Exon_number | 1/8 | |||||||
T09A12.4h.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T09A12.4h.1:c.176-19_259+4del | |||||||
Intron_number | 1-2/8 | |||||||
Exon_number | 2/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 15365/15366-15472/15473 (107 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |