WormBase Tree Display for Variation: WBVar02148359

WBVar02148359 Name: Public_name: tm10621
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_II
    Flanking_sequences: aaattatatagtgctgagaggatgagtcat atgagcagcaggatatcttcgatgtggaga
    Mapping_target: CHROMOSOME_II
    Source_location: 7 CHROMOSOME_II 14695428 14710711 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm10621_external
      tm10621_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 10621
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007479
      WBGene00007478
    Transcript: C09F9.1.1
      C09F9.2.1
      C09F9.1.2
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: [K02B7]15295/15296-[C09F9]15222/15223 (15282 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target K02B7 updated based on the VEP analysis pipeline to CHROMOSOME_II.
  Method: NBP_knockout_allele