WormBase Tree Display for Variation: WBVar02147887

WBVar02147887 Name: Public_name: tm10069
    Other_name: F55C12.6.1:c.468_548del
      CE38963:p.Asp157_Asp183del
    HGVSg: CHROMOSOME_II:g.5875390_5875470del
  Sequence_details: SMap: S_parent: Sequence: F55C12
    Flanking_sequences: agtttgctcaccttgacaacaatttcacaa cttctccctgtagcttttaaccaaaagttc
    Mapping_target: F55C12
    Source_location: 7 CHROMOSOME_II 5875389 5875471 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm10069_external
      tm10069_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 10069
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018873
    Transcript: F55C12.6.1 VEP_consequence: inframe_deletion
        VEP_impact: MODERATE
        HGVSc: F55C12.6.1:c.468_548del
        HGVSp: CE38963:p.Asp157_Asp183del
        cDNA_position: 520-600
        CDS_position: 468-548
        Protein_position: 156-183
        Exon_number: 4/7
        Codon_change: agTGATATTGGTGCATGTACATATTATATATCGTATTATGAATTGTATGATTTTAAAGTTCCAATTCCAAAGATTAAAGATGAt/agt
        Amino_acid_change: SDIGACTYYISYYELYDFKVPIPKIKDD/S
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 18180/18181-18261/18262 (81 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele