WormBase Tree Display for Variation: WBVar02147400
expand all nodes | collapse all nodes | view schema
| WBVar02147400 | Evidence | Paper_evidence | WBPaper00049445 | |||
|---|---|---|---|---|---|---|
| Name | Public_name | r452 | ||||
| Other_name (28) | ||||||
| HGVSg | CHROMOSOME_I:g.4068589del | |||||
| Sequence_details | SMap | S_parent | Sequence | C24G7 | ||
| Flanking_sequences | tgaagagaaaccagaatctggagagttctctc | cactatcccatcgtctaagaaatctgatggggg | ||||
| Mapping_target | C24G7 | |||||
| Type_of_mutation | Deletion | t | Paper_evidence | WBPaper00049445 | ||
| SeqStatus | Sequenced | |||||
| Variation_type | Allele | |||||
| Origin | Species | Caenorhabditis elegans | ||||
| Laboratory | TR | |||||
| Status | Live | |||||
| Affects | Gene | WBGene00006820 | ||||
| Transcript (14) | ||||||
| Genetics | Interpolated_map_position | I | -1.7286 | |||
| Reference | WBPaper00049445 | |||||
| Remark | Exact T bp (in Ig39) was calculated by finding a 6kb Exon containing 20 Ig domains as this is referenced in the publication as Ig 27-47. This exon was then put through interpro to identify where Ig39 is (aa 1166-1258 in the exon) and then looking for a frameshifted ORF large enough to contain the 92 additional aa talked about in the paper and working back from the stop codon. | Curator_confirmed | WBPerson1983 | |||
| Old Mapping_target C09D1 updated based on the VEP analysis pipeline to C24G7. | ||||||
| Method | Deletion_allele |
