WormBase Tree Display for Variation: WBVar02146926

WBVar02146926 Name: Public_name: tm6536
    Other_name: F59A1.10.1:c.426+45_660delinsGTGAAGACCGGA
    HGVSg: CHROMOSOME_V:g.17660774_17661299delinsGTGAAGACCGGA
  Sequence_details: SMap: S_parent: Sequence: F59A1
    Flanking_sequences: aaaaatttgaaaatttcacatagaaaaacc gtgagagaagccgtgaagaccggagctcat
    Mapping_target: F59A1
    Source_location: 7 CHROMOSOME_V 17660773 17661300 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GTGAAGACCGGA
      Deletion
    PCR_product: tm6536_external
      tm6536_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6536
    NBP_allele
    Status: Live
  Affects (3)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Remark: 9305/9306-GTGAAGACCGGA-9831/9832 (526 bp deletion + 12 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele