WormBase Tree Display for Variation: WBVar02146588
expand all nodes | collapse all nodes | view schema
| WBVar02146588 | Evidence | Paper_evidence | WBPaper00049807 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | kr300 | |||||
| Other_name | C34C12.5.1:c.-6_*154del | ||||||
| HGVSg | CHROMOSOME_III:g.3472003_3473722del | ||||||
| Sequence_details | SMap | S_parent | Sequence | C34C12 | |||
| Flanking_sequences | aaaaaaggatgtaaaaaattaaaatttcag | atcatcattttattcaaaaattatgcaaaa | |||||
| Mapping_target | C34C12 | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Engineered_allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | EN | ||||||
| Production_method | CRISPR_Cas9 | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00007928 | |||||
| WBGene00007924 | |||||||
| Transcript | C34C12.5.1 | VEP_consequence | transcript_ablation | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | C34C12.5.1:c.-6_*154del | ||||||
| cDNA_position | 1-967 | ||||||
| Intron_number | 2-5/6 | ||||||
| Exon_number | 1-7/7 | ||||||
| C34C12.5.2 | VEP_consequence | transcript_ablation | |||||
| VEP_impact | HIGH | ||||||
| cDNA_position | 1-? | ||||||
| Intron_number | 2-7/7 | ||||||
| Exon_number | 1-8/8 | ||||||
| C34C12.9.1 | VEP_consequence | 3_prime_UTR_variant | |||||
| VEP_impact | MODIFIER | ||||||
| cDNA_position | 1054-? | ||||||
| Exon_number | 5/5 | ||||||
| Description | Phenotype | WBPhenotype:0001685 | Paper_evidence | WBPaper00049718 | |||
| Curator_confirmed | WBPerson25274 | ||||||
| Remark | reduced amount of acetylcholine receptors, illegitimate clustering of extrasynaptic receptor | Paper_evidence | WBPaper00049718 | ||||
| Curator_confirmed | WBPerson25274 | ||||||
| Reference | WBPaper00049718 | ||||||
| WBPaper00065297 | |||||||
| Method | Engineered_allele |
