WormBase Tree Display for Variation: WBVar02145196

WBVar02145196 Name: Public_name: tm8025
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_II
    Flanking_sequences: tacggattccaaccactttgtatctcatgt tacttcacctttaaattaaaagaatttaac
    Mapping_target: CHROMOSOME_II
    Source_location: 7 CHROMOSOME_II 6910266 6932159 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GTCGACGG
      Deletion
    PCR_product: tm8025_external
      tm8025_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 8025
    NBP_allele
    Status: Live
  Affects: Gene (12)
    Transcript (17)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Remark: [B0252]10670/10671-GTCGACGG-[F22D3]7162/7163 (21892 bp deletion + 8 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target B0252 updated based on the VEP analysis pipeline to CHROMOSOME_II.
  Method: NBP_knockout_allele