WormBase Tree Display for Variation: WBVar02145196
expand all nodes | collapse all nodes | view schema
WBVar02145196 | Name | Public_name | tm8025 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_II | ||||
Flanking_sequences | tacggattccaaccactttgtatctcatgt | tacttcacctttaaattaaaagaatttaac | ||||||
Mapping_target | CHROMOSOME_II | |||||||
Source_location | 7 | CHROMOSOME_II | 6910266 | 6932159 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | GTCGACGG | ||||||
Deletion | ||||||||
PCR_product | tm8025_external | |||||||
tm8025_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 8025 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene (12) | |||||||
Transcript (17) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Remark | [B0252]10670/10671-GTCGACGG-[F22D3]7162/7163 (21892 bp deletion + 8 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target B0252 updated based on the VEP analysis pipeline to CHROMOSOME_II. | ||||||||
Method | NBP_knockout_allele |