WormBase Tree Display for Variation: WBVar02144982

WBVar02144982 Name: Public_name: tm7805
    Other_name: B0414.2.2:c.69+104_69+211del
      B0414.2.1:c.69+104_69+211del
      B0414.2.3:c.69+104_69+211del
    HGVSg: CHROMOSOME_I:g.5784013_5784120del
  Sequence_details: SMap: S_parent: Sequence: B0414
    Flanking_sequences: tttcttaagtcatttattcggttttcggaa aataattttgaattgagcatttcgattcga
    Mapping_target: B0414
    Source_location: 7 CHROMOSOME_I 5784012 5784121 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm7805_external
      tm7805_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 7805
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004393
    Transcript: B0414.2.3 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: B0414.2.3:c.69+104_69+211del
        Intron_number: 5/12
      B0414.2.2 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: B0414.2.2:c.69+104_69+211del
        Intron_number: 5/12
      B0414.2.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: B0414.2.1:c.69+104_69+211del
        Intron_number: 2/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 12423/12424-12531/12532 (108 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele