WormBase Tree Display for Variation: WBVar02144749

WBVar02144749 Evidence: Paper_evidence: WBPaper00061133
  Name: Public_name: tm7601
    HGVSg: CHROMOSOME_II:g.8439123_8439232del
  Sequence_details: SMap: S_parent: Sequence: F14E5
    Flanking_sequences: agtcaagacacagacggttcgaaggacact gttatttttggatgtgctcatgcaaagttt
    Mapping_target: F14E5
    Source_location: 7 CHROMOSOME_II 8439122 8439233 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm7601_external
      tm7601_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00048362
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 7601
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00008803
    Transcript: F14E5.5.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-65
        CDS_position: ?-36
        Protein_position: ?-12
        Exon_number: 1-2/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00061133
  Remark: 21291/21292-21401/21402 (110 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele