WormBase Tree Display for Variation: WBVar02144557
expand all nodes | collapse all nodes | view schema
WBVar02144557 | Evidence | Paper_evidence | WBPaper00032256 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ft1 | ||||||
Other_name (34) | ||||||||
HGVSg | CHROMOSOME_IV:g.12781691G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK897 | ||||
Flanking_sequences | gacgccaaactgtgcgcgaagtccagaatg | tacaccatgacattaccaaaaagtagtcag | ||||||
Mapping_target | ZK897 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00032256 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | KQ | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006767 | ||||||
Transcript (17) | ||||||||
Interactor | WBInteraction000525338 | |||||||
Genetics | Interpolated_map_position | IV | 6.31913 | |||||
Description | Phenotype | WBPhenotype:0001184 | Paper_evidence | WBPaper00053887 | ||||
Curator_confirmed | WBPerson37651 | |||||||
Remark | Supplemental figure 2 | Paper_evidence | WBPaper00053887 | |||||
Curator_confirmed | WBPerson37651 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00053887 | ||||
Curator_confirmed | WBPerson37651 | |||||||
WBPhenotype:0001513 | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The unc-31(ft1) mutation resulted in decreased accumulation of the DAF-28::mCherry reporter in coelomocytes (Figure S7C). | Paper_evidence | WBPaper00045372 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | DAF-28::mCherry | Paper_evidence | WBPaper00045372 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00032256 | |||||||
WBPaper00045372 | ||||||||
WBPaper00053887 | ||||||||
Method | Substitution_allele |