WormBase Tree Display for Variation: WBVar02144229

WBVar02144229 Name: Public_name: tm6988
    HGVSg: CHROMOSOME_II:g.5415223_5415440del
  Sequence_details: SMap: S_parent: Sequence: EEED8
    Flanking_sequences: tcaaaaatggaaatcttgtggttttcaaca cttggttcgcggaatttggcattttttggt
    Mapping_target: EEED8
    Source_location: 7 CHROMOSOME_II 5415222 5415441 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6988_external
      tm6988_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6988
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00017134
    Transcript: EEED8.3.1 VEP_consequence: coding_sequence_variant,3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 745-?
        CDS_position: 539-?
        Protein_position: 180-?
        Exon_number: 4-5/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Remark: 31840/31841-32058/32059 (218 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele