WormBase Tree Display for Variation: WBVar02141272
expand all nodes | collapse all nodes | view schema
WBVar02141272 | Evidence | Paper_evidence | WBPaper00045993 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | rp13 | |||||||
Other_name | K11G9.4.1:c.530_646-28del | ||||||||
HGVSg | CHROMOSOME_V:g.6679900_6680416del | ||||||||
Sequence_details | SMap | S_parent | Sequence | K11G9 | |||||
Flanking_sequences | gacaaaagattgacgagattccaaatgtca | aacacacaatttgctccatttttgcaggtg | |||||||
Mapping_target | K11G9 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | RJP | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001210 | |||||||
Transcript | K11G9.4.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | K11G9.4.1:c.530_646-28del | ||||||||
cDNA_position | 536-? | ||||||||
CDS_position | 530-? | ||||||||
Protein_position | 177-? | ||||||||
Intron_number | 5/6 | ||||||||
Exon_number | 5/7 | ||||||||
Genetics | Interpolated_map_position | V | 0.132674 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00045993 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00045993 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | loss of egl-46 affected the expression of gcy-9, gcy-31 and flp-19, indicating that egl-46 expression is required for both O2 and CO2 aspects of BAG cell fate | Paper_evidence | WBPaper00045993 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006825 | PATO:0000460 | Paper_evidence | WBPaper00045993 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00045993 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutants exhibited partial loss of gcy-33prom::GFP expression (a marker for BAG neurons); however, egl-46 does not affect the expression of ets-5 or egl-13 reporters | Paper_evidence | WBPaper00045993 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006825 | PATO:0000460 | Paper_evidence | WBPaper00045993 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00045993 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | egl-46 mutant animals show a reduced response to 1% CO2 with regard to change of speed and omega turns. | Paper_evidence | WBPaper00045993 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
we observed a defect in the ability of egl-46 mutant animals to respond to an O2 downshift from 21% O2 to 17% O2 but not to an O2 upshift from 17% O2 to 21% O2 (Figure 3). However, egl-46 mutant animals exhibit a similar response compared to wild-type animals with regard to change of speed and v-turns in response to an O2 downshift from 21% O2 to 10% O2 (BAG- mediated behavior) and O2 upshift from 10% O2 to 21% O2 (URX-mediated behavior) (Zimmer et al. 2009) (Figure S3). | Paper_evidence | WBPaper00045993 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006825 | PATO:0000460 | Paper_evidence | WBPaper00045993 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00045993 | ||||||||
Method | Deletion_allele |