WormBase Tree Display for Variation: WBVar02125540

WBVar02125540 Name: Public_name: tm6709
    Other_name: B0348.6c.1:c.43_381del
      B0348.6b.1:c.43_384del
      CE30590:p.Gly15_Ter127delextTer?
      CE27570:p.Gly15_Ter128delextTer?
      CE17331:p.Gly15_Ter125delextTer?
      B0348.6a.1:c.43_375del
    HGVSg: CHROMOSOME_V:g.7355_7776del
  Sequence_details: SMap: S_parent: Sequence: B0348
    Flanking_sequences: ctctccaacaatagccatcaacagctccaa ggaagctgacaatgctttgttttccgctac
    Mapping_target: B0348
    Source_location: 7 CHROMOSOME_V 7354 7777 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6709_external
      tm6709_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6709
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002061
    Transcript: B0348.6c.1 (11)
      B0348.6a.1 (11)
      B0348.6b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 2325/2326-2747/2748 (422 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele