WormBase Tree Display for Variation: WBVar02125360
expand all nodes | collapse all nodes | view schema
| WBVar02125360 | Evidence | Paper_evidence | WBPaper00044839 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | hm71 | |||||
| Other_name | T26H10.1a.2:c.631+1G>T | ||||||
| T26H10.1b.1:c.631+1G>T | |||||||
| T26H10.1a.1:c.631+1G>T | |||||||
| HGVSg | CHROMOSOME_V:g.11417886C>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | K03B8 | |||
| Flanking_sequences | acgaaggatggtacattttacaaacaaaaa | tgagcatttaaatgactaaatcattaatga | |||||
| Mapping_target | K03B8 | ||||||
| Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00044839 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | MF | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000955 | |||||
| Transcript | T26H10.1a.1 | VEP_consequence | splice_donor_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | T26H10.1a.1:c.631+1G>T | ||||||
| Intron_number | 5/10 | ||||||
| T26H10.1a.2 | VEP_consequence | splice_donor_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | T26H10.1a.2:c.631+1G>T | ||||||
| Intron_number | 6/11 | ||||||
| T26H10.1b.1 | VEP_consequence | splice_donor_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | T26H10.1b.1:c.631+1G>T | ||||||
| Intron_number | 6/12 | ||||||
| Genetics | Interpolated_map_position | V | 3.09331 | ||||
| Description | Phenotype | WBPhenotype:0001790 | Paper_evidence | WBPaper00044839 | |||
| Curator_confirmed | WBPerson661 | ||||||
| Remark | imaging study shows reduced responses to cold | Paper_evidence | WBPaper00044839 | ||||
| Curator_confirmed | WBPerson661 | ||||||
| WBPhenotype:0002028 | Paper_evidence | WBPaper00044839 | |||||
| Curator_confirmed | WBPerson661 | ||||||
| Remark | imaging study shows reduced responses to high threshold mechanical stimuli | Paper_evidence | WBPaper00044839 | ||||
| Curator_confirmed | WBPerson661 | ||||||
| Reference | WBPaper00044839 | ||||||
| Method | Substitution_allele |
