WormBase Tree Display for Variation: WBVar02125182

WBVar02125182 Name: Public_name: tm6526
    Other_name: F16H6.1.1:c.368-35_1152del
    HGVSg: CHROMOSOME_V:g.18192679_18193603del
  Sequence_details: SMap: S_parent: Sequence: F16H6
    Flanking_sequences: aactggaaaataaaatctttgaattcttgt cagtggtacacatcgacaacaaatacgatg
    Mapping_target: F16H6
    Source_location: 7 CHROMOSOME_V 18192678 18193604 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product (2)
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6526
    NBP_allele
    Status: Live
  Affects (2)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 3015/3016-3940/3941 (925 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele