WormBase Tree Display for Variation: WBVar02124617
expand all nodes | collapse all nodes | view schema
| WBVar02124617 | Name | Public_name | WBVar02124617 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | cewivar00855540 | |||||||
| Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
| Flanking_sequences | ATGAGTTTAGTTTCCTCTAGCATTGTCACA | GTGGTCTTGCGAGACCATGGCTATCTATCA | ||||||
| Mapping_target | CHROMOSOME_V | |||||||
| Source_location | 225 | CHROMOSOME_V | 3265001 | 3347000 | From_analysis | Million_mutation_project_reanalysis | ||
| Type_of_mutation | Deletion | |||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Natural_variant | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00027660 | From_analysis | Million_mutation_project_reanalysis | |||||
| Laboratory | VC | |||||||
| Analysis | Million_mutation_project_reanalysis | |||||||
| Status | Live | |||||||
| Affects | Gene (35) | |||||||
| Transcript (37) | ||||||||
| Pseudogene | F35F10.4 | |||||||
| F35F10.10 | ||||||||
| T28A11.5 | ||||||||
| Remark | The boundaries of this variant have been identified only approximately | |||||||
| This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
| Method | WGS_Flibotte |
