WormBase Tree Display for Variation: WBVar02124384
expand all nodes | collapse all nodes | view schema
WBVar02124384 | Name | Public_name | WBVar02124384 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855307 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y26D4A | ||||
Flanking_sequences | TCATCTCCACCAACTTTTTTTGAGCGACTC | AAATCATCAAAAATAATTAAAGTCTTTTTA | ||||||
Mapping_target | Y26D4A | |||||||
Source_location | 225 | CHROMOSOME_I | 13080001 | 13095000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00024204 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00027647 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00012505 | ||||||
WBGene00007655 | ||||||||
WBGene00077528 | ||||||||
WBGene00012504 | ||||||||
WBGene00012509 | ||||||||
WBGene00045236 | ||||||||
Transcript | C17H1.2.1 | |||||||
Y26D4A.12.1 | ||||||||
Y26D4A.6.1 | ||||||||
Y26D4A.20 | ||||||||
Y26D4A.8.1 | ||||||||
Pseudogene | Y26D4A.19a | |||||||
Y26D4A.19b | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |