WormBase Tree Display for Variation: WBVar02124307
expand all nodes | collapse all nodes | view schema
WBVar02124307 | Name | Public_name | WBVar02124307 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855230 | |||||||
Sequence_details | SMap | S_parent | Sequence | F12B6 | ||||
Flanking_sequences | TAAATATCATCAAAGGTCATCCAGATTCCA | GCCAAATGGGACAATATGGCTGAATTATAG | ||||||
Mapping_target | F12B6 | |||||||
Source_location | 225 | CHROMOSOME_I | 2240680 | 2244175 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023665 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00021007 | ||||||
WBGene00170253 | ||||||||
WBGene00017399 | ||||||||
Transcript | F12B6.3b.1 | |||||||
F12B6.3a.1 | ||||||||
W03F11.4.2 | ||||||||
F12B6.4 | ||||||||
W03F11.4.1 | ||||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |