WormBase Tree Display for Variation: WBVar02124279
expand all nodes | collapse all nodes | view schema
WBVar02124279 | Name | Public_name | WBVar02124279 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855202 | |||||||
HGVSg | CHROMOSOME_V:g.18682029_18692028del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y69H2 | ||||
Flanking_sequences | CCACAAAATTTCAAAATTTCAAAATTTTCAAACTTTCAAAAATTTCAAAATTCCAAAAAA | CTCGAAAATTCAAAATTTTGAACTTAAAAA | ||||||
Mapping_target | Y69H2 | |||||||
Source_location | 225 | CHROMOSOME_V | 18682001 | 18692000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023072 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00305873 | ||||||
WBGene00199367 | ||||||||
WBGene00305869 | ||||||||
WBGene00305870 | ||||||||
WBGene00013485 | ||||||||
WBGene00077455 | ||||||||
WBGene00013482 | ||||||||
WBGene00006714 | ||||||||
Transcript (11) | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |