WormBase Tree Display for Variation: WBVar02124275
expand all nodes | collapse all nodes | view schema
WBVar02124275 | Name | Public_name | WBVar02124275 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855198 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
Flanking_sequences | TTCATAAAATAATCTCATAAAATTATTTCA | GGTGGTCCTGTCGATTTTTTTAATTGAAGG | ||||||
Mapping_target | CHROMOSOME_V | |||||||
Source_location | 225 | CHROMOSOME_V | 18190001 | 18296000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023072 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (33) | |||||||
Transcript (31) | ||||||||
Pseudogene | Y51A2A.3 | |||||||
F16H6.11 | ||||||||
Y37H2C.5 | ||||||||
R10E8.7 | ||||||||
Y37H2B.1 | ||||||||
Y37H2C.1 | ||||||||
Y51A2A.18 | ||||||||
R10E8.4 | ||||||||
Y51A2A.2 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |