WormBase Tree Display for Variation: WBVar02123725
expand all nodes | collapse all nodes | view schema
WBVar02123725 | Name | Public_name | WBVar02123725 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854648 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
Flanking_sequences | TTTCCGGTTCAAAAAAAAATCAATAATAAA | TTTAAAATTTTATATCCAAAAATATAATTT | ||||||
Mapping_target | CHROMOSOME_V | |||||||
Source_location | 225 | CHROMOSOME_V | 20134001 | 20239000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022886 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00031113 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (38) | |||||||
Transcript (37) | ||||||||
Pseudogene | F19B2.2 | |||||||
Y113G7A.t3 | ||||||||
F19B2.12 | ||||||||
Y113G7B.14 | ||||||||
Y113G7B.t2 | ||||||||
Y113G7B.26 | ||||||||
F19B2.4 | ||||||||
F19B2.1 | ||||||||
F19B2.10 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |