WormBase Tree Display for Variation: WBVar02123719
expand all nodes | collapse all nodes | view schema
WBVar02123719 | Name | Public_name | WBVar02123719 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854642 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
Flanking_sequences | TTTAACTTATGGAGCTTCCGGACGATATGC | TACTACTTGAATATATCAAGGCTAAAAGAG | ||||||
Mapping_target | CHROMOSOME_V | |||||||
Source_location | 225 | CHROMOSOME_V | 18135001 | 18145000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022886 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00012570 | ||||||
WBGene00012568 | ||||||||
WBGene00045416 | ||||||||
WBGene00012571 | ||||||||
WBGene00045417 | ||||||||
WBGene00012569 | ||||||||
Transcript | Y37H2A.14.1 | |||||||
Y37H2A.13.1 | ||||||||
Y37H2A.11.1 | ||||||||
Y37H2A.10b.1 | ||||||||
Y37H2A.10c.1 | ||||||||
Y37H2A.10a.1 | ||||||||
Pseudogene | Y37H2A.9 | |||||||
Y37H2A.8 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |