WormBase Tree Display for Variation: WBVar02123483
expand all nodes | collapse all nodes | view schema
WBVar02123483 | Name | Public_name | WBVar02123483 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854406 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_X | ||||
Flanking_sequences | GTTGTCGGCATTGGCTGGCTGCGAAGGGTC | TCGAGACGATATTGGCTTCTGTCCGCCGTG | ||||||
Mapping_target | CHROMOSOME_X | |||||||
Source_location | 225 | CHROMOSOME_X | 3750001 | 3773000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022856 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00018534 | ||||||
WBGene00018535 | ||||||||
WBGene00018533 | ||||||||
WBGene00020515 | ||||||||
WBGene00018536 | ||||||||
WBGene00018537 | ||||||||
WBGene00003359 | ||||||||
WBGene00235110 | ||||||||
WBGene00219411 | ||||||||
Transcript | F47B7.3.1 | |||||||
T14G12.7 | ||||||||
F47B7.4.1 | ||||||||
F47B7.2c.1 | ||||||||
T14G12.6.1 | ||||||||
F47B7.5.1 | ||||||||
F47B7.2a.1 | ||||||||
F47B7.2b.1 | ||||||||
T14G12.12.1 | ||||||||
T14G12.11.1 | ||||||||
Pseudogene | F47B7.6 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |