WormBase Tree Display for Variation: WBVar02123297
expand all nodes | collapse all nodes | view schema
WBVar02123297 | Name | Public_name | WBVar02123297 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854220 | |||||||
Sequence_details | SMap | S_parent | Sequence | K06B4 | ||||
Flanking_sequences | GCAACCTGACAAACTTTCACGTCCACTCCG | ACGTTTTAGTGCATCAAATCGCACTTCGAA | ||||||
Mapping_target | K06B4 | |||||||
Source_location | 225 | CHROMOSOME_V | 15673001 | 15687000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022850 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00077596 | ||||||
WBGene00003642 | ||||||||
WBGene00305508 | ||||||||
WBGene00010598 | ||||||||
WBGene00003641 | ||||||||
WBGene00010600 | ||||||||
WBGene00050954 | ||||||||
WBGene00077595 | ||||||||
Transcript | K06B4.5.1 | |||||||
K06B4.1.1 | ||||||||
K06B4.18 | ||||||||
K06B4.2.1 | ||||||||
Pseudogene | K06B4.3 | |||||||
K06B4.14 | ||||||||
K06B4.17 | ||||||||
K06B4.16 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |