WormBase Tree Display for Variation: WBVar02122569
expand all nodes | collapse all nodes | view schema
WBVar02122569 | Name | Public_name | WBVar02122569 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853492 | |||||||
Sequence_details | SMap | S_parent | Sequence | T16G12 | ||||
Flanking_sequences | AAGTGCCATGACATCTGAAATGTGGTATTC | CTGTAGTTTCTAACCTAAACGCGCATGCAA | ||||||
Mapping_target | T16G12 | |||||||
Source_location | 225 | CHROMOSOME_III | 10043001 | 10063000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023139 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00027648 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00011809 | ||||||
WBGene00011805 | ||||||||
WBGene00269433 | ||||||||
WBGene00011803 | ||||||||
WBGene00306001 | ||||||||
WBGene00044222 | ||||||||
WBGene00050922 | ||||||||
WBGene00011804 | ||||||||
Transcript (13) | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |