WormBase Tree Display for Variation: WBVar02122468
expand all nodes | collapse all nodes | view schema
WBVar02122468 | Name | Public_name | WBVar02122468 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853391 | |||||||
Sequence_details | SMap | S_parent | Sequence | C17B7 | ||||
Flanking_sequences | GTTCTAACGCATTTGCAGTATCCATTATATAATTGAAGAATCCACCGACATCTTCAGTATCATTCTTGATTTTATAGTCCTCCAAGTTCACGTCGCCTCCCAGTGGATTGCAAAACTTTTCCTAAAAAAATAGATACCTATACCGTATTTTCCTTTTTTCATCTTAAATT | TCTTCCGAAAGATGACGAATTGATGATTTT | ||||||
Mapping_target | C17B7 | |||||||
Source_location | 225 | CHROMOSOME_V | 3321001 | 3335000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023138 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00015882 | ||||||
WBGene00015879 | ||||||||
WBGene00015883 | ||||||||
Transcript | C17B7.8a.1 | |||||||
C17B7.5.1 | ||||||||
C17B7.8b.1 | ||||||||
C17B7.9.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |