WormBase Tree Display for Variation: WBVar02122186
expand all nodes | collapse all nodes | view schema
WBVar02122186 | Name | Public_name | WBVar02122186 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853109 | |||||||
Sequence_details | SMap | S_parent | Sequence | K08H2 | ||||
Flanking_sequences | GCTTTCAGATTTTCAGATTTTCACTTGACA | ATATAGGTCACGACCCAAATTATTTAGAAA | ||||||
Mapping_target | K08H2 | |||||||
Source_location | 225 | CHROMOSOME_X | 13242804 | 13243343 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006640 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00023072 | From_analysis | Million_mutation_project_reanalysis | ||||||
WBStrain00024204 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |