WormBase Tree Display for Variation: WBVar02122116
expand all nodes | collapse all nodes | view schema
WBVar02122116 | Name | Public_name | WBVar02122116 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853039 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | TCCTCACTATCAGTTTTTGCCACTCATAAT | CAACACACCAGATCCTACGACATTGGCTCC | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 225 | CHROMOSOME_III | 922001 | 988000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006640 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (25) | |||||||
Transcript (25) | ||||||||
Pseudogene | R06B10.1 | |||||||
T12B5.18 | ||||||||
T12B5.9 | ||||||||
T12B5.13 | ||||||||
R06B10.2 | ||||||||
T12B5.12 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |