WormBase Tree Display for Variation: WBVar02122027
expand all nodes | collapse all nodes | view schema
WBVar02122027 | Name | Public_name | WBVar02122027 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00852950 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
Flanking_sequences | AGAATTTTTTCATATTCCTCCGGTAATTCA | AATTGTGAGGTAGAGAGAAAGAAGAAGAAG | ||||||
Mapping_target | CHROMOSOME_V | |||||||
Source_location | 225 | CHROMOSOME_V | 4899001 | 4919000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006637 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00019232 | ||||||
WBGene00019233 | ||||||||
WBGene00019235 | ||||||||
WBGene00015340 | ||||||||
WBGene00019234 | ||||||||
WBGene00020594 | ||||||||
WBGene00044534 | ||||||||
WBGene00019236 | ||||||||
Transcript | H23N18.2.1 | |||||||
H23N18.3.1 | ||||||||
H23N18.5.1 | ||||||||
H23N18.4.1 | ||||||||
T19H12.11.1 | ||||||||
C02E7.7.1 | ||||||||
H23N18.1.1 | ||||||||
H23N18.6.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |