WormBase Tree Display for Variation: WBVar02121897
expand all nodes | collapse all nodes | view schema
WBVar02121897 | Name | Public_name | WBVar02121897 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00852820 | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK550 | ||||
Flanking_sequences | CGTCGACGATTGGGCGGCTTCCTTACTACT | AAAAATAATTGAAAAATGGCTGAATTTTTC | ||||||
Mapping_target | ZK550 | |||||||
Source_location | 225 | CHROMOSOME_IV | 17241287 | 17252033 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006631 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00022886 | From_analysis | Million_mutation_project_reanalysis | ||||||
WBStrain00023072 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (18) | |||||||
Transcript (17) | ||||||||
Pseudogene | ZK550.1 | |||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |