WormBase Tree Display for Variation: WBVar02121353
expand all nodes | collapse all nodes | view schema
WBVar02121353 | Name | Public_name | WBVar02121353 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00852276 | |||||||
Sequence_details | SMap | S_parent | Sequence | R07A4 | ||||
Flanking_sequences | CATGAAAGTTTGCCCTTTGTCTTTTTTCGT | TATTTGAATAATAAAATGTTAACGGTAAGC | ||||||
Mapping_target | R07A4 | |||||||
Source_location | 225 | CHROMOSOME_X | 10741001 | 10759000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004602 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001202 | ||||||
WBGene00011073 | ||||||||
WBGene00011074 | ||||||||
WBGene00011075 | ||||||||
WBGene00199977 | ||||||||
Transcript | R07A4.3.2 | |||||||
R07A4.5 | ||||||||
R07A4.1.1 | ||||||||
R07A4.2.1 | ||||||||
R07A4.3.1 | ||||||||
R07A4.4.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |