WormBase Tree Display for Variation: WBVar02121032

WBVar02121032 Name: Public_name: WBVar02121032
    Other_name: cewivar00851955
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_IV
    Flanking_sequences: ATAATTATTTTTTCTTTTTTGAATATTTAA CTTACGATTTAAATTTCAAGCATCTCAACG
    Mapping_target: CHROMOSOME_IV
    Source_location: 225 CHROMOSOME_IV 12723001 12741000 From_analysis: Million_mutation_project_reanalysis
    Type_of_mutation: Tandem_duplication
    SeqStatus: Sequenced
  Variation_type: Natural_variant
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004600 From_analysis: Million_mutation_project_reanalysis
    Laboratory: VC
    Analysis: Million_mutation_project_reanalysis
    Status: Live
  Affects (3)
  Remark: The boundaries of this variant have been identified only approximately
    This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous
  Method: WGS_Flibotte