WormBase Tree Display for Variation: WBVar02120680
expand all nodes | collapse all nodes | view schema
WBVar02120680 | Name | Public_name | WBVar02120680 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851603 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | AGTAGAAAAAATGTTTATTTGTCTAGATAA | AACTTCGTTTTCCATCTCTTCCAGCTCTTC | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 225 | CHROMOSOME_III | 4037001 | 4055000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000034 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00004602 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00305337 | ||||||
WBGene00199706 | ||||||||
WBGene00198119 | ||||||||
WBGene00004322 | ||||||||
WBGene00189944 | ||||||||
WBGene00014728 | ||||||||
WBGene00011369 | ||||||||
Transcript | E03A3.2.1 | |||||||
T02C12.6 | ||||||||
E03A3.12 | ||||||||
T02C12.7 | ||||||||
Pseudogene | E03A3.10 | |||||||
E03A3.1 | ||||||||
T02C12.4 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |