WormBase Tree Display for Variation: WBVar02120635
expand all nodes | collapse all nodes | view schema
WBVar02120635 | Name | Public_name | WBVar02120635 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851558 | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK666 | ||||
Flanking_sequences | GCTTCAACATCTCCTGCTCCAGCCCATCTC | ATTCTTGTAGTTCTTGGCTGATTTGGATCG | ||||||
Mapping_target | ZK666 | |||||||
Source_location | 225 | CHROMOSOME_II | 10477499 | 10490061 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (12) | ||||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00044046 | ||||||
WBGene00014047 | ||||||||
WBGene00195145 | ||||||||
WBGene00014045 | ||||||||
WBGene00014046 | ||||||||
WBGene00014049 | ||||||||
WBGene00014044 | ||||||||
Transcript | ZK666.11a.1 | |||||||
ZK666.11b.1 | ||||||||
ZK666.15.2 | ||||||||
ZK666.4.1 | ||||||||
ZK666.15.1 | ||||||||
ZK666.7.1 | ||||||||
ZK666.5.1 | ||||||||
ZK666.6.1 | ||||||||
Pseudogene | ZK666.13 | |||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |