WormBase Tree Display for Variation: WBVar01473793

WBVar01473793 Name: Public_name: tm6057
    Other_name: CE09309:p.Met138_Ter377delextTer?
      F10C2.5.1:c.412_1131del
    HGVSg: CHROMOSOME_V:g.12045843_12046663del
  Sequence_details: SMap: S_parent: Sequence: F10C2
    Flanking_sequences: agagttgttggcggattaatatctgcacat ttacggcctgaaatggttgaatcattgatg
    Mapping_target: F10C2
    Source_location: 7 CHROMOSOME_V 12045842 12046664 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6057_external
      tm6057_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6057
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00008646
    Transcript: F10C2.5.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 23129/23130-23950/23951 (821 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele