WormBase Tree Display for Variation: WBVar01473793
expand all nodes | collapse all nodes | view schema
WBVar01473793 | Name | Public_name | tm6057 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE09309:p.Met138_Ter377delextTer? | |||||||
F10C2.5.1:c.412_1131del | ||||||||
HGVSg | CHROMOSOME_V:g.12045843_12046663del | |||||||
Sequence_details | SMap | S_parent | Sequence | F10C2 | ||||
Flanking_sequences | agagttgttggcggattaatatctgcacat | ttacggcctgaaatggttgaatcattgatg | ||||||
Mapping_target | F10C2 | |||||||
Source_location | 7 | CHROMOSOME_V | 12045842 | 12046664 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm6057_external | |||||||
tm6057_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 6057 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00008646 | ||||||
Transcript | F10C2.5.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 23129/23130-23950/23951 (821 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |