WormBase Tree Display for Variation: WBVar01473613
expand all nodes | collapse all nodes | view schema
| WBVar01473613 | Evidence | Paper_evidence | WBPaper00041364 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | tn1385 | |||||
| Other_name | CE23832:p.Gly533Arg | ||||||
| H27M09.1.1:c.1597G>A | |||||||
| HGVSg | CHROMOSOME_I:g.6853721G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | H27M09 | |||
| Flanking_sequences | ttattttcagttcatcgaattggtcgtacc | gacgttccggacggaaaggtctcgcaacga | |||||
| Mapping_target | H27M09 | ||||||
| Type_of_mutation | Substitution | g | a | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00005684 | ||||||
| WBStrain00005691 | |||||||
| WBStrain00005692 | |||||||
| Laboratory | DG | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00019245 | |||||
| Transcript | H27M09.1.1 (12) | ||||||
| Interactor | WBInteraction000524686 | ||||||
| WBInteraction000524763 | |||||||
| WBInteraction000524764 | |||||||
| WBInteraction000524765 | |||||||
| WBInteraction000524766 | |||||||
| WBInteraction000524767 | |||||||
| WBInteraction000524773 | |||||||
| WBInteraction000524774 | |||||||
| Genetics | Interpolated_map_position | I | 1.40525 | ||||
| Description | Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00041364 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | sacy-1 mutant is comparably viable with wild type in in trans to the deficiency qDf16. | Paper_evidence | WBPaper00041364 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00041364 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000688 | Paper_evidence | WBPaper00041364 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | sacy-1 mutant is comparably fertile with wild type, even in trans to deficiency qDf16. sacy-1(tn1385) has a brood size of 349 +/- 77 (n = 35), compared to a wild-type brood size of 339 +/- 31 (n = 37, P value = 0.49). | Paper_evidence | WBPaper00041364 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00041364 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00041364 | ||||||
| Method | Substitution_allele |
