WormBase Tree Display for Variation: WBVar01429642

WBVar01429642 Name: Public_name: tm5990
    Other_name: F40A3.7.1:c.303+76_365del
    HGVSg: CHROMOSOME_V:g.7898984_7899431del
  Sequence_details: SMap: S_parent: Sequence: F40A3
    Flanking_sequences: ttctgaattccaagaagccgatcaccacac aacctggattctgtaaactctccccaacat
    Mapping_target: F40A3
    Source_location: 7 CHROMOSOME_V 7898983 7899432 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5990_external
      tm5990_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5990
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018222
    Transcript: F40A3.7.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F40A3.7.1:c.303+76_365del
        cDNA_position: ?-365
        CDS_position: ?-365
        Protein_position: ?-122
        Intron_number: 2/8
        Exon_number: 3/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 30474/30475-30922/30923 (448 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele