WormBase Tree Display for Variation: WBVar01429599

WBVar01429599 Name: Public_name: tm5916
    Other_name: C04F5.3.1:c.-80_144del
    HGVSg: CHROMOSOME_V:g.5098709_5098983del
  Sequence_details: SMap: S_parent: Sequence: C04F5
    Flanking_sequences: tagtattttgacttgaaatgtcacactgat gaagaacaaataattccgtgtggagcacgg
    Mapping_target: C04F5
    Source_location: 7 CHROMOSOME_V 5098708 5098984 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5916_external
      tm5916_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5916
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006782
    Transcript: C04F5.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C04F5.3.1:c.-80_144del
        cDNA_position: 43-266
        CDS_position: ?-144
        Protein_position: ?-48
        Intron_number: 2/8
        Exon_number: 1-3/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 9329/9330-9604/9605 (275 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele