WormBase Tree Display for Variation: WBVar01429551
expand all nodes | collapse all nodes | view schema
WBVar01429551 | Name | Public_name | tm2078 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F11F1.7.1:c.20_328-55del | ||||||||
HGVSg | CHROMOSOME_III:g.13404780_13405510del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F11F1 | |||||
Flanking_sequences | tttcaaaacatatgtcgagatttttgattt | cttatagatcagaaagccaaacttttttgc | |||||||
Mapping_target | F11F1 | ||||||||
Source_location | 7 | CHROMOSOME_III | 13404779 | 13405511 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm2078_external | ||||||||
tm2078_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 2078 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00008719 | |||||||
Transcript | F11F1.7.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11F1.7.1:c.20_328-55del | ||||||||
cDNA_position | 63-? | ||||||||
CDS_position | 20-? | ||||||||
Protein_position | 7-? | ||||||||
Intron_number | 2-3/4 | ||||||||
Exon_number | 2-3/5 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | III | |||||||
Description | Phenotype | WBPhenotype:0000590 | Paper_evidence | WBPaper00041205 | |||||
Curator_confirmed | WBPerson3997 | ||||||||
WBPhenotype:0001911 | Paper_evidence | WBPaper00046306 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00046306 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
WBPhenotype:0002365 | Paper_evidence | WBPaper00046306 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Table S1 | Paper_evidence | WBPaper00046306 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000243 | Paper_evidence | WBPaper00050421 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | No persistent corpses in the pharynx of L1 (Supplemental Table 1) | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002486 | Paper_evidence | WBPaper00050421 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Mutations in genes within the ced-1/6/7 pathway (ced-1, ced-7, nrf-5, ttr-52), the ced-2/5/12 pathway (ced-2, ced-5), or both pathways (ced-1;ced-2 and ced-7;ced-5) did not cause PGC lobes to persist in L1 larvae (Supplementary Table 1), indicating that ced-10 functions in PGC lobe scission in a different context than it does in cell corpse engulfment." (PGC = 'primordial germ cell') | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004576 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004575 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | All strains include the xnIs360 or xnSi1 transgenes to visualize PGC membranes. | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00041205 | ||||||||
WBPaper00046306 | |||||||||
WBPaper00050421 | |||||||||
Remark | 8240/8241-8971/8972 (731 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |