WormBase Tree Display for Variation: WBVar01429545
expand all nodes | collapse all nodes | view schema
WBVar01429545 | Name | Public_name | tm5848 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | W03G9.7.1:c.248_490del | |||||||
CE33195:p.Ile84_Tyr164delextTer? | ||||||||
HGVSg | CHROMOSOME_I:g.4988635_4988952del | |||||||
Sequence_details | SMap | S_parent | Sequence | W03G9 | ||||
Flanking_sequences | ctgtttcctgtcgaaccattgcatcctcgt | tgatataatcctggaacaaaacacattttc | ||||||
Mapping_target | W03G9 | |||||||
Source_location | 7 | CHROMOSOME_I | 4988634 | 4988953 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm5848_external | |||||||
tm5848_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 5848 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00021017 | ||||||
Transcript | W03G9.7.1 (11) | |||||||
Interactor | WBInteraction000525375 | |||||||
WBInteraction000525376 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype (4) | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00046900 | |||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |