WormBase Tree Display for Variation: WBVar01429502
expand all nodes | collapse all nodes | view schema
| WBVar01429502 | Evidence | Paper_evidence | WBPaper00040041 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | u701 | |||||||
| Other_name | CE06083:p.Trp232AlafsTer9 | ||||||||
| K03B8.9.1:c.694_1301del | |||||||||
| K03B8.9.2:c.694_1301del | |||||||||
| HGVSg | CHROMOSOME_V:g.11413627_11414337del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | K03B8 | |||||
| Flanking_sequences | agcatgcaatcattcattccaaatgaagaa | gccacagtcggctggaagtgtttctgaaaa | |||||||
| Mapping_target | K03B8 | ||||||||
| Type_of_mutation | Deletion | ||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | TU | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000951 | |||||||
| Transcript | K03B8.9.2 (11) | ||||||||
| K03B8.9.1 (11) | |||||||||
| Interactor | WBInteraction000518320 | ||||||||
| Genetics | Interpolated_map_position | V | 3.08423 | ||||||
| Description | Phenotype | WBPhenotype:0000643 | Paper_evidence | WBPaper00041959 | |||||
| Curator_confirmed | WBPerson557 | ||||||||
| Remark | Exhibited significantly reduced general locomotor activity compared to control worms. Authors refer to this allele as tu1851, which is the strain name. The allele of deg-3 in this strain is u701. | Paper_evidence | WBPaper00041959 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| WBPhenotype:0001790 | Paper_evidence | WBPaper00044839 | |||||||
| Curator_confirmed | WBPerson661 | ||||||||
| Remark | imaging study shows reduced responses to cold | Paper_evidence | WBPaper00044839 | ||||||
| Curator_confirmed | WBPerson661 | ||||||||
| WBPhenotype:0002028 | Paper_evidence | WBPaper00044839 | |||||||
| Curator_confirmed | WBPerson661 | ||||||||
| Remark | imaging study shows reduced responses to high threshold mechanical stimuli | Paper_evidence | WBPaper00044839 | ||||||
| Curator_confirmed | WBPerson661 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000384 | Paper_evidence | WBPaper00040041 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals do not exhibit axon guidance defects. | Paper_evidence | WBPaper00040041 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00040041 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000643 | Paper_evidence | WBPaper00002167 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | revertant of the dominant Unc phenotype associated with the u662 mutation | Paper_evidence | WBPaper00002167 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00002167 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000886 | Paper_evidence | WBPaper00002167 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | revertant of u662; these revertants are phenotypically wild type | Paper_evidence | WBPaper00002167 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00002167 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00040041 | ||||||||
| WBPaper00041959 | |||||||||
| WBPaper00002167 | |||||||||
| WBPaper00044839 | |||||||||
| Method | Deletion_allele |
