WormBase Tree Display for Variation: WBVar00603993

WBVar00603993 Name: Public_name: tm5713
    Other_name: T07D3.6:n.558_906del
    HGVSg: CHROMOSOME_II:g.881323_881987del
  Sequence_details: SMap: S_parent: Sequence: T07D3
    Flanking_sequences: aaaatgttggataataatgtttgcaaatgg acccatttctcagcggcgggacatttctcg
    Mapping_target: T07D3
    Source_location: 7 CHROMOSOME_II 881322 881988 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5713_external
      tm5713_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5713
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00020309
    Pseudogene: T07D3.6 VEP_consequence: splice_acceptor_variant,splice_donor_variant,non_coding_transcript_exon_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T07D3.6:n.558_906del
        cDNA_position: 558-906
        Intron_number: 4-6/9
        Exon_number: 4-7/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 8860/8861-9525/9526 (665 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele