WormBase Tree Display for Variation: WBVar00601116
expand all nodes | collapse all nodes | view schema
| WBVar00601116 | Name | Public_name | gk3109 | ||||
|---|---|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_III:g.725657_726836del | ||||||
| Sequence_details | SMap | S_parent | Sequence | C24A1 | |||
| Flanking_sequences | tttcgaaagcttgccgcaaaactctgccat | agacctaaaaattccggcaaataccacatt | |||||
| Mapping_target | C24A1 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | gk3109_external | ||||||
| gk3109_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00037000 | ||||||
| Laboratory | VC | ||||||
| Person | WBPerson427 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00016028 | |||||
| Transcript | C24A1.1.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| Intron_number | 2/3 | ||||||
| Exon_number | 3-4/4 | ||||||
| Isolation | Mutagen | UV/TMP | |||||
| Description | Phenotype_not_observed | WBPhenotype:0002432 | Paper_evidence | WBPaper00050011 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Null mutation of this neuropeptide had little or no effect on stress-induced sleep. To determine whether ALA-enriched neuropeptides are necessary for stress-induced sleep, we assayed locomotion, head movement, pharyngeal pumping, avoidance response, and defecation before and 30 min after heat shock. Single-null mutants were indistinguishable from wild-type with respect to pumping, locomotion, and head movement after heat shock. | Paper_evidence | WBPaper00050011 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00050011 | ||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
