WormBase Tree Display for Variation: WBVar00601019

WBVar00601019 Name: Public_name: tm5673
    HGVSg: CHROMOSOME_I:g.8133940_8134178del
  Sequence_details: SMap: S_parent: Sequence: T28B8
    Flanking_sequences: ttggtggtgtctttcactttcactacgtat gggatccgatgaagaatctactgccgcccc
    Mapping_target: T28B8
    Source_location: 7 CHROMOSOME_I 8133939 8134179 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5673_external
      tm5673_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5673
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012113
    Transcript: T28B8.1.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-64
        CDS_position: ?-35
        Protein_position: ?-12
        Exon_number: 1-2/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 2974/2975-3213/3214 (239 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele