WormBase Tree Display for Variation: WBVar00600740
expand all nodes | collapse all nodes | view schema
WBVar00600740 | Evidence | Paper_evidence | WBPaper00040149 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | u332 | |||||||
Other_name | F16F9.5.1:c.2039G>A | ||||||||
CE09444:p.Gly680Glu | |||||||||
HGVSg | CHROMOSOME_X:g.8466142C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F16F9 | |||||
Flanking_sequences | aaatgatggctgattttggaggacaccttg | actttggtcaggagtttctgttatgacttg | |||||||
Mapping_target | F16F9 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00040149 | ||||
SeqStatus | Not_sequenced | ||||||||
Deletion_verification | |||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | TU | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003174 | |||||||
Transcript | F16F9.5.1 (12) | ||||||||
Genetics | Interpolated_map_position | X | 0.00712395 | ||||||
Description | Phenotype | WBPhenotype:0000456 | Paper_evidence | WBPaper00040149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | On average, mec-10 mutant animals respond only to 1-4 touches of 10, whereas wild-type animals respond to 9 touches of 10. | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002028 | Paper_evidence | WBPaper00040149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants have MRCs with a dramatic reduction in peak MRC size compared to wild-type. Touch receptor neuron respond to applied pressure stimulus. Latency for MRC off response are extended compared to wild type. Mutations in MEC-10 shifted the reversal potential for MRCs by -40 mV or more. | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00040149 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The distribution of the mechanoreceptor channels along the process of PLM touch receptor neurons is essentially unchanged in mec-10 mutants as assayed by the localization pattern of MEC-4::YFP and anti-MEC-2 antibody staining. | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040149 | ||||||||
Method | Substitution_allele |