WormBase Tree Display for Variation: WBVar00317512
expand all nodes | collapse all nodes | view schema
WBVar00317512 | Name | Public_name | tm3165 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | H17B01.1b.1:c.217-76_395del | |||||||
H17B01.1a.1:c.163-76_341del | ||||||||
HGVSg | CHROMOSOME_II:g.1505630_1505980del | |||||||
Sequence_details | SMap | S_parent | Sequence | H17B01 | ||||
Flanking_sequences | aaaaactttcaactagtgaaatatgcaaaa | caataatcttttggctctggccgcggcggc | ||||||
Mapping_target | H17B01 | |||||||
Source_location | 7 | CHROMOSOME_II | 1505629 | 1505981 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm3165_external | |||||||
tm3165_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00054893 | |||||||
WBStrain00054896 | ||||||||
WBStrain00054898 | ||||||||
WBStrain00054922 | ||||||||
WBStrain00054928 | ||||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3165 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00019207 | ||||||
Transcript | H17B01.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | H17B01.1b.1:c.217-76_395del | |||||||
cDNA_position | ?-395 | |||||||
CDS_position | ?-395 | |||||||
Protein_position | ?-132 | |||||||
Intron_number | 2-3/8 | |||||||
Exon_number | 3-4/9 | |||||||
H17B01.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | H17B01.1a.1:c.163-76_341del | |||||||
cDNA_position | ?-343 | |||||||
CDS_position | ?-341 | |||||||
Protein_position | ?-114 | |||||||
Intron_number | 3-4/10 | |||||||
Exon_number | 4-5/11 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0001184 | Paper_evidence | WBPaper00042558 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | fgt-1(tm3165) mutant animal showed 9 percent higher fat storage compared with wild-type animals. Fat content measured by Sudan black B staining. | Paper_evidence | WBPaper00042558 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00042558 | ||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00049337 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Expression of the daf-7 TGF-beta ligand in ASI (Ren et al. 1996; Schackwitz et al. 1996) was unaffected upon loss of maco-1 function [FigureS1; 100% of wild-type and maco-1(tm3165) animals expressed daf-7p::gfp in ASI; n = 20 each]. | Paper_evidence | WBPaper00049337 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00049337 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00005103 | Paper_evidence | WBPaper00049337 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBMol:00005104 | Paper_evidence | WBPaper00049337 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBMol:00005110 | Paper_evidence | WBPaper00049337 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBMol:00005127 | Paper_evidence | WBPaper00049337 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | daf-7p::gfp | Paper_evidence | WBPaper00049337 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00042558 | |||||||
WBPaper00049337 | ||||||||
Remark | 35925/35926-36276/36277 (351 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |